ID: 1130321455_1130321460

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1130321455 1130321460
Species Human (GRCh38) Human (GRCh38)
Location 15:82846017-82846039 15:82846036-82846058
Sequence CCAACTGCCCTCTGTGCACAGTC AGTCTTCCTGGGTGTTGATCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 28, 4: 244} {0: 1, 1: 0, 2: 1, 3: 8, 4: 133}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!