ID: 1130330148_1130330154

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1130330148 1130330154
Species Human (GRCh38) Human (GRCh38)
Location 15:82916096-82916118 15:82916134-82916156
Sequence CCTTGAAGGACTTGAGTGTCACT CAGAGGAAACAAAATAATGGGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 0, 3: 13, 4: 133} {0: 1, 1: 0, 2: 2, 3: 51, 4: 640}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!