ID: 1130331376_1130331391

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1130331376 1130331391
Species Human (GRCh38) Human (GRCh38)
Location 15:82924987-82925009 15:82925039-82925061
Sequence CCCTTTTCCTCTCCCCCTACCAC CAGCTGATCTTGGGGTAAACAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 8, 3: 146, 4: 1353} {0: 1, 1: 0, 2: 2, 3: 8, 4: 80}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!