ID: 1130340830_1130340836

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1130340830 1130340836
Species Human (GRCh38) Human (GRCh38)
Location 15:82998345-82998367 15:82998367-82998389
Sequence CCGGGCGGAGAGGCTCCTCACTT TCTCAGATGGGGCAGCTGCCGGG
Strand - +
Off-target summary {0: 275, 1: 2694, 2: 8362, 3: 5948, 4: 4283} {0: 20, 1: 340, 2: 723, 3: 1614, 4: 4108}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!