ID: 1130353023_1130353035

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1130353023 1130353035
Species Human (GRCh38) Human (GRCh38)
Location 15:83107874-83107896 15:83107908-83107930
Sequence CCGCGGGACAGAGGTTCGTGGCC CCGCGCCTGGCCAGACTAGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 74} {0: 1, 1: 0, 2: 1, 3: 13, 4: 136}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!