ID: 1130365248_1130365251

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1130365248 1130365251
Species Human (GRCh38) Human (GRCh38)
Location 15:83232164-83232186 15:83232188-83232210
Sequence CCCTGATTCTTTTTAGTGGGTAA GGTATATAGAGACCACAATCTGG
Strand - +
Off-target summary No data {0: 1, 1: 2, 2: 18, 3: 76, 4: 240}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!