|
Left Crispr |
Right Crispr |
| Crispr ID |
1130391141 |
1130391146 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
15:83456407-83456429
|
15:83456454-83456476
|
| Sequence |
CCTCGTTGCCACCTTGCAGTTTG |
CAGCGCGATTCCGTGGGCGTAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 17, 1: 856, 2: 1865, 3: 1609, 4: 1162} |
{0: 16, 1: 450, 2: 786, 3: 859, 4: 831} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|