ID: 1130403237_1130403243

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1130403237 1130403243
Species Human (GRCh38) Human (GRCh38)
Location 15:83576532-83576554 15:83576583-83576605
Sequence CCAGGTTTTGAATGTAGCACCTC CATCACCTGAAAAAGCTGGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 99} {0: 1, 1: 0, 2: 0, 3: 16, 4: 178}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!