ID: 1130403241_1130403243

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1130403241 1130403243
Species Human (GRCh38) Human (GRCh38)
Location 15:83576566-83576588 15:83576583-83576605
Sequence CCATTCTCTTTTTTTAGCATCAC CATCACCTGAAAAAGCTGGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 42, 4: 526} {0: 1, 1: 0, 2: 0, 3: 16, 4: 178}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!