ID: 1130405662_1130405664

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1130405662 1130405664
Species Human (GRCh38) Human (GRCh38)
Location 15:83598714-83598736 15:83598759-83598781
Sequence CCAATTTCAAGGAGATAAGCTAC AATGTTCAATTTTAACAGAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 103} {0: 1, 1: 0, 2: 0, 3: 24, 4: 299}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!