ID: 1130411982_1130411989

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1130411982 1130411989
Species Human (GRCh38) Human (GRCh38)
Location 15:83654818-83654840 15:83654839-83654861
Sequence CCCGCACTGGCCGCCTCCCTTCA CAGCCAGGAGTCGCCGCCTCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 285} {0: 1, 1: 0, 2: 0, 3: 11, 4: 232}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!