ID: 1130431292_1130431296

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1130431292 1130431296
Species Human (GRCh38) Human (GRCh38)
Location 15:83849671-83849693 15:83849700-83849722
Sequence CCTTTACCAGGAGGCCATTTGTC TTATGAATGGCCCATTCTGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 35, 4: 605} {0: 1, 1: 0, 2: 0, 3: 10, 4: 177}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!