ID: 1130434607_1130434611

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1130434607 1130434611
Species Human (GRCh38) Human (GRCh38)
Location 15:83885346-83885368 15:83885397-83885419
Sequence CCTGAATGCAATCGTGTTAATGA GACAGGTGCAAAACTGGATTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 72} {0: 1, 1: 0, 2: 0, 3: 7, 4: 162}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!