ID: 1130435841_1130435846

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1130435841 1130435846
Species Human (GRCh38) Human (GRCh38)
Location 15:83898596-83898618 15:83898616-83898638
Sequence CCACATGAAAGAGCAGAAATGGG GGGTAGCATCCAGGGATAGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 235} {0: 1, 1: 0, 2: 2, 3: 9, 4: 146}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!