ID: 1130445905_1130445914

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1130445905 1130445914
Species Human (GRCh38) Human (GRCh38)
Location 15:84001732-84001754 15:84001762-84001784
Sequence CCTGAGGACTGCCCCATGGTATG GGGAGAGTACACTGGGAGCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 125} {0: 1, 1: 0, 2: 0, 3: 16, 4: 247}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!