ID: 1130457083_1130457091

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1130457083 1130457091
Species Human (GRCh38) Human (GRCh38)
Location 15:84121531-84121553 15:84121577-84121599
Sequence CCCCAAACCTGTGCTCCAGGAAG GCATTTGCTCGGGTGTTCAGTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 2, 3: 42, 4: 449} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!