ID: 1130460085_1130460097

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1130460085 1130460097
Species Human (GRCh38) Human (GRCh38)
Location 15:84154071-84154093 15:84154114-84154136
Sequence CCTGCTGGGCACCAGGACAGCTC TCAGCCTTGAGACAGAGTCAGGG
Strand - +
Off-target summary No data {0: 3, 1: 0, 2: 2, 3: 16, 4: 223}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!