ID: 1130479769_1130479782 |
View in Genome Browser |
Spacer: 29 |
| Left Crispr | Right Crispr | |
|---|---|---|
| Crispr ID | 1130479769 | 1130479782 |
| Species | Human (GRCh38) | Human (GRCh38) |
| Location | 15:84350621-84350643 | 15:84350673-84350695 |
| Sequence | CCAACCAAAGCCTAGTCAGTCAG | CTGCCCTTGCCAATCACCCCAGG |
| Strand | - | + |
| Off-target summary | No data | {0: 9, 1: 1, 2: 23, 3: 28, 4: 222} |
| Status | Not started | |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer | Left Crispr | Right Crispr | ||||||
|---|---|---|---|---|---|---|---|---|
| Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
| No off target data available for this pair! | ||||||||