ID: 1130483910_1130483914

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1130483910 1130483914
Species Human (GRCh38) Human (GRCh38)
Location 15:84387084-84387106 15:84387106-84387128
Sequence CCTTCAGCAAGCCGCTCAGTCCC CTGCCCTTGCCAATCACCCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 18, 3: 22, 4: 142} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!