ID: 1130486443_1130486450

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1130486443 1130486450
Species Human (GRCh38) Human (GRCh38)
Location 15:84400926-84400948 15:84400949-84400971
Sequence CCATTTTCAAGGGCTGGCAGGGG GACCCCTCTGGAGGTACTTGGGG
Strand - +
Off-target summary No data {0: 4, 1: 3, 2: 4, 3: 9, 4: 138}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!