ID: 1130491988_1130492002

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1130491988 1130492002
Species Human (GRCh38) Human (GRCh38)
Location 15:84437456-84437478 15:84437509-84437531
Sequence CCTGGGGTGATTGGCAAGGGCAG TGACTGACTAGGCTTTGGTTGGG
Strand - +
Off-target summary {0: 9, 1: 1, 2: 23, 3: 28, 4: 222} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!