ID: 1130520642_1130520649

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1130520642 1130520649
Species Human (GRCh38) Human (GRCh38)
Location 15:84658351-84658373 15:84658368-84658390
Sequence CCCAGAGACCTGCACACCCACAC CCACACTCTGGCCCGCACGCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 41, 4: 503} {0: 1, 1: 0, 2: 0, 3: 6, 4: 221}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!