ID: 1130538634_1130538639

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1130538634 1130538639
Species Human (GRCh38) Human (GRCh38)
Location 15:84804547-84804569 15:84804583-84804605
Sequence CCCTTAACCTCACTGTCTCCTCT GTTAGTAATTCCCATCCAACTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 8, 3: 43, 4: 490} {0: 1, 1: 0, 2: 0, 3: 5, 4: 81}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!