ID: 1130541940_1130541948

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1130541940 1130541948
Species Human (GRCh38) Human (GRCh38)
Location 15:84826756-84826778 15:84826790-84826812
Sequence CCTGGAGCAGCCAACCATGTTTC TGGTATCCAGGGATGGAGCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 131} {0: 1, 1: 0, 2: 4, 3: 27, 4: 259}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!