ID: 1130550070_1130550079

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1130550070 1130550079
Species Human (GRCh38) Human (GRCh38)
Location 15:84884727-84884749 15:84884766-84884788
Sequence CCTCTGGATGCTGACAGAAACAA CAGTAGGAGAGGAGGGAAGGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 30, 4: 251} {0: 1, 1: 3, 2: 19, 3: 199, 4: 1779}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!