ID: 1130597893_1130597897

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1130597893 1130597897
Species Human (GRCh38) Human (GRCh38)
Location 15:85259322-85259344 15:85259342-85259364
Sequence CCCAGAGTCACTCAGCAGCCAGT AGTCGGACAGACTCAAACGCTGG
Strand - +
Off-target summary {0: 3, 1: 0, 2: 4, 3: 60, 4: 606} {0: 2, 1: 0, 2: 0, 3: 6, 4: 52}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!