ID: 1130619329_1130619330

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1130619329 1130619330
Species Human (GRCh38) Human (GRCh38)
Location 15:85445283-85445305 15:85445311-85445333
Sequence CCACTGAAAGGGGCTTCATCTCT TGCATTTCGAGAGCTCACAGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 207} {0: 1, 1: 0, 2: 0, 3: 18, 4: 102}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!