ID: 1130647339_1130647346

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1130647339 1130647346
Species Human (GRCh38) Human (GRCh38)
Location 15:85740788-85740810 15:85740841-85740863
Sequence CCCCAGGTAATACCACTGACTGC CGTGAGTTCCTGCACCTTTGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 128} {0: 1, 1: 0, 2: 0, 3: 5, 4: 92}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!