ID: 1130693602_1130693605

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1130693602 1130693605
Species Human (GRCh38) Human (GRCh38)
Location 15:86107844-86107866 15:86107862-86107884
Sequence CCTCTCAGAGAGCTTCTCAAAGC AAAGCCTGGTGCATCCATATGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 6, 4: 92}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!