ID: 1130714487_1130714490

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1130714487 1130714490
Species Human (GRCh38) Human (GRCh38)
Location 15:86318265-86318287 15:86318298-86318320
Sequence CCCACTATCCATGTTAACATAAA GCCACTAGTGTGTCTCTCCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 192} {0: 1, 1: 0, 2: 0, 3: 11, 4: 93}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!