ID: 1130737793_1130737799

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1130737793 1130737799
Species Human (GRCh38) Human (GRCh38)
Location 15:86568784-86568806 15:86568821-86568843
Sequence CCCTTGGTCAAAGAGGTGAGGTA AAGGGTCAAGCATAGGAAGTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 133} {0: 1, 1: 0, 2: 0, 3: 3, 4: 150}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!