ID: 1130755713_1130755717

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1130755713 1130755717
Species Human (GRCh38) Human (GRCh38)
Location 15:86760838-86760860 15:86760857-86760879
Sequence CCACCCTAGAGAGGAAAAGCCAC CCACAACTTAAGTTTCTGTAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 19, 4: 164} {0: 1, 1: 0, 2: 0, 3: 6, 4: 107}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!