ID: 1130757754_1130757761

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1130757754 1130757761
Species Human (GRCh38) Human (GRCh38)
Location 15:86783929-86783951 15:86783957-86783979
Sequence CCCCCACTTTTCTTAAAAAAATT CTGCTGGTTTAGAGGAGGAATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 12, 3: 85, 4: 938} {0: 1, 1: 0, 2: 1, 3: 32, 4: 309}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!