ID: 1130774466_1130774471

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1130774466 1130774471
Species Human (GRCh38) Human (GRCh38)
Location 15:86964400-86964422 15:86964420-86964442
Sequence CCACTACCCCCACTGTGATAACA ACAAAAAATGTGTCCAGACATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 188} {0: 1, 1: 1, 2: 37, 3: 147, 4: 1235}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!