ID: 1130779180_1130779182

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1130779180 1130779182
Species Human (GRCh38) Human (GRCh38)
Location 15:87016864-87016886 15:87016899-87016921
Sequence CCAAGGCCTTGGGTCTGATACAG AGTCCCTGCAGAGCAGCCACTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 16, 3: 67, 4: 264} {0: 1, 1: 0, 2: 4, 3: 31, 4: 272}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!