ID: 1130846600_1130846604

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1130846600 1130846604
Species Human (GRCh38) Human (GRCh38)
Location 15:87753575-87753597 15:87753609-87753631
Sequence CCAGGGTCGGGTCTCCAACGCCC AGCTAGTGAGAGTGCCCGTCAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 1, 4: 60}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!