ID: 1130873454_1130873458

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1130873454 1130873458
Species Human (GRCh38) Human (GRCh38)
Location 15:87991324-87991346 15:87991373-87991395
Sequence CCAAAACCTACCGGATTGGGATC TTTCTATGCAGAGTAAAATGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 62} {0: 1, 1: 0, 2: 2, 3: 41, 4: 338}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!