ID: 1130875305_1130875312

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1130875305 1130875312
Species Human (GRCh38) Human (GRCh38)
Location 15:88008641-88008663 15:88008680-88008702
Sequence CCCAGTCTCCTGACACTCAAGGC GTTCTGATGAGGAGCAACCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 179} {0: 1, 1: 0, 2: 0, 3: 7, 4: 121}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!