ID: 1130881413_1130881420

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1130881413 1130881420
Species Human (GRCh38) Human (GRCh38)
Location 15:88059083-88059105 15:88059131-88059153
Sequence CCTCTGGCTACAGCCATTTAGAG CAGCAGCAATGGCAAGCAGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 155} {0: 1, 1: 0, 2: 4, 3: 27, 4: 308}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!