ID: 1130893091_1130893101

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1130893091 1130893101
Species Human (GRCh38) Human (GRCh38)
Location 15:88150010-88150032 15:88150042-88150064
Sequence CCCCTGCCTTTAGCTCCCTACCC GCCTCCCTGAACAAAACCCATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 35, 4: 370} {0: 1, 1: 0, 2: 1, 3: 16, 4: 142}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!