ID: 1130893093_1130893101

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1130893093 1130893101
Species Human (GRCh38) Human (GRCh38)
Location 15:88150012-88150034 15:88150042-88150064
Sequence CCTGCCTTTAGCTCCCTACCCCT GCCTCCCTGAACAAAACCCATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 314} {0: 1, 1: 0, 2: 1, 3: 16, 4: 142}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!