ID: 1130907632_1130907641

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1130907632 1130907641
Species Human (GRCh38) Human (GRCh38)
Location 15:88251675-88251697 15:88251712-88251734
Sequence CCCTGGTCCTTCTACAGAGTTGG TGGCAGGGACTGGCAAGGCAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 3, 4: 121} {0: 1, 1: 0, 2: 3, 3: 47, 4: 733}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!