ID: 1130918220_1130918227

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1130918220 1130918227
Species Human (GRCh38) Human (GRCh38)
Location 15:88322765-88322787 15:88322781-88322803
Sequence CCTTCTCCCACAGCAGTCCAAAG TCCAAAGCTCAGGCCTGGGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 505} {0: 1, 1: 0, 2: 5, 3: 31, 4: 295}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!