ID: 1130919193_1130919196

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1130919193 1130919196
Species Human (GRCh38) Human (GRCh38)
Location 15:88330005-88330027 15:88330018-88330040
Sequence CCCTGCAGATGATGCAGAGAAGG GCAGAGAAGGCTCTCCCTTAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 30, 4: 317} {0: 1, 1: 0, 2: 3, 3: 14, 4: 148}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!