ID: 1130919193_1130919199

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1130919193 1130919199
Species Human (GRCh38) Human (GRCh38)
Location 15:88330005-88330027 15:88330036-88330058
Sequence CCCTGCAGATGATGCAGAGAAGG TAAGGCTCCCCGCTTCTACTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 30, 4: 317} {0: 1, 1: 0, 2: 0, 3: 2, 4: 47}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!