ID: 1130935170_1130935175

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1130935170 1130935175
Species Human (GRCh38) Human (GRCh38)
Location 15:88464060-88464082 15:88464077-88464099
Sequence CCATGTCTAGAGATATTTTTGGT TTTGGTTACTGCACTGGGGGTGG
Strand - +
Off-target summary {0: 1, 1: 8, 2: 40, 3: 94, 4: 307} {0: 1, 1: 0, 2: 1, 3: 8, 4: 130}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!