ID: 1130938879_1130938887

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1130938879 1130938887
Species Human (GRCh38) Human (GRCh38)
Location 15:88491461-88491483 15:88491484-88491506
Sequence CCAGGCAGTGAAGGGCCTGCAGA GGAGGCTGGGGCGTGCCTAAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 35, 4: 287} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!