ID: 1130942056_1130942067

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1130942056 1130942067
Species Human (GRCh38) Human (GRCh38)
Location 15:88519069-88519091 15:88519099-88519121
Sequence CCTGCCTGACTCACCGACTCCCT AAAGGTAAAATGATGGGGGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 252} {0: 1, 1: 0, 2: 3, 3: 43, 4: 449}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!