ID: 1130968184_1130968191

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1130968184 1130968191
Species Human (GRCh38) Human (GRCh38)
Location 15:88712303-88712325 15:88712339-88712361
Sequence CCAGGGCTGCTGAAAGCTGGTTG CCTCAGGGACCATGAATAGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 31, 4: 190} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!