ID: 1130979859_1130979867

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1130979859 1130979867
Species Human (GRCh38) Human (GRCh38)
Location 15:88804796-88804818 15:88804847-88804869
Sequence CCATGAAGAAGCTGGAGTTCCAG CTGTGGGGCTGGCTGCCAGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 29, 4: 294} {0: 1, 1: 0, 2: 20, 3: 61, 4: 580}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!